If you're seeing this message, it means we're having trouble loading external resources on our website.

If you're behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked.

Main content

Impact of mutations on translation into amino acids

AP.BIO:
IST‑2 (EU)
,
IST‑2.E (LO)
,
IST‑2.E.2 (EK)
Using an amino acid translation table to understand the impact of point and frameshift mutations.

Want to join the conversation?

  • blobby green style avatar for user edwardlessey612
    What is codons and mutations? I can't get to fully understand.
    (2 votes)
    Default Khan Academy avatar avatar for user
    • starky sapling style avatar for user jas55555
      Codons are a group of three nucleotides, while mutations are mistakes in a cell's DNA where certain nucleotides are either swapped, inserted, deleted (I think there are other examples too but these are the main ones), which can either have small effects (example: changing one amino acid) or huge effects (example: changing the protein permanently). Hope this helped!
      (1 vote)
  • blobby green style avatar for user kazbrekker777
    How does a frameshift mutation occur naturally? Considering the fact that it would need a sizable amount of energy to actually insert a nucleotide , as it involves breaking the strand itself, so where does this energy come from?
    (1 vote)
    Default Khan Academy avatar avatar for user
  • leaf green style avatar for user David Tremblay
    What is the likeliest outcome of a base substitution mutation
    within an intron?
    (0 votes)
    Default Khan Academy avatar avatar for user
  • blobby green style avatar for user janet-rogers
    Suppose a random mutation occurs that changes the GGA codon to GGU. What effect does this mutation have on the amino acid being called for?
    (0 votes)
    Default Khan Academy avatar avatar for user
  • blobby green style avatar for user williskelsi
    I know there is probably a simple answer for this, but I can't seem to figure it out. At ~ frameshift mutations are discussed. What I'm wondering, is how is the rest of the chromosome downstream of that frameshift mutation is not effected? Does it have to do with heterochromatin?
    (0 votes)
    Default Khan Academy avatar avatar for user
  • starky sapling style avatar for user jas55555
    So do point mutations include frameshift mutations? Because I searched point mutations up and it is apparently a change in a single nucleotide of DNA (swap, insertion, deletion), and a frameshift seems to be an an insertion or deletion that changes the reading frame of the DNA.
    (0 votes)
    Default Khan Academy avatar avatar for user
  • duskpin seed style avatar for user Courtney Campbell
    When would you use U-A?
    (0 votes)
    Default Khan Academy avatar avatar for user
  • boggle yellow style avatar for user Emma
    what type of diseases can you get from bad mutations?
    (0 votes)
    Default Khan Academy avatar avatar for user
    • sneak peak green style avatar for user Aiden Thatcher
      Well, a good example of a disease that you could get from a bad mutation, is Sickle Cell Anima. Sickle Cell Anima is caused when 1 codon (DNA code unit) is inherited in its mutated version from both parents. That one single error in the many, many codons that code a red blood cell, causes a whole slew of errors in the creation of the body’s red blood cells. The codon in question causes the misplacement of a single atom in the hemoglobin protein, that causes it fold over during its production. This causes the new red blood cells to sickle shaped (Like a ( shape), thus the name, and causes numerous malfunctions within the cell. Sickle Cell Disease is just one example of the many bad things that one can get from a bad genetic mutation and it is very interesting that one tiny little error in the DNA code could have such a tremendous effect in a person. Other examples of genetic disorders include Muscular Dystrophy, Down’s Syndrome, and Cystic Fibrosis. I hope I answered your question. :)
      (11 votes)
  • blobby green style avatar for user firefighter034
    Hello,

    My name is Keanu and I am pursuing Health Science. I recently got an assignment that I have submitted, but I feel as if I did not fully understand. The assignment asked for us to communicate how the overall protein structure is affected with a depletion point (Uracil) on the RNA structure. It had one extra Cytosine at the end. The following mRNA is as follows.

    AGUUGUUAUCGAAAACUGCGAGUAAAUAUCCUGAGGGCGCGAAGCAACC

    UGU had the depletion point while C is the extra codon at the end. How does this work? What would be the overall effect on the protein?
    (0 votes)
    Default Khan Academy avatar avatar for user
  • blobby green style avatar for user madduxdearden
    What does mCNA mean?
    (0 votes)
    Default Khan Academy avatar avatar for user

Video transcript

- [Instructor] So, let's start looking at a short sequence of DNA, and the letters I'm going to use, these are the shorthands for the various nucleotide bases that make up a sequence of DNA. So, let's say that I have some thymine, thymine, cytosine, guanine, cytosine, thymine, adenine, thymine, thymine, and let's throw another thymine in there. So, that would be our sequence of DNA, and what would be the corresponding sequence of RNA that it would be transcribed into? If you remember this from previous videos, pause this video and try to figure that out. Well, the key thing to appreciate is, if we're talking base pairs in DNA, adenine pairs with thymine, cytosine pairs with guanine, but if we're talking about pairing into RNA, well then, instead of thymine in the RNA, you would have uracil. So, the RNA here is, well, the thymine in the DNA would correspond to an adenine in the RNA, adenine, guanine, cytosine, guanine, adenine, and now, since this is an RNA strand, instead of having a thymine right over here, this would be a uracil, adenine, adenine, adenine. So, this process that we just did, this is transcription. Transcription, transcription from DNA, DNA to RNA. Now, the next step, if we're talking about the whole process of, how does this information actually have an effect on the body, is we're gonna go from the RNA and translate that into a protein. And the way we do that, we've seen this in previous videos, is every three of these bases, that's a codon, and it codes for a particular amino acid. Now, to figure out what amino acid it codes for, we look at an amino acid translation table, and there's different types that you might see. This is the most typical type, so the first base is A, second base is A, third base is G. First base, A, second base, A, we're in this cell, third base is G, and so that will code for the amino acid, lysine, so we could write l-y-s, short for lysine here. And we could've also gotten that from a different type of translation table. For example, you might see a circular one that looks like that, but we would've gotten the same result. AAG, start at the center, AAG codes for lysine. Then, the next codon, and if you're getting as excited about this as I am, I encourage you to pause this video and try to keep translating this. The next codon is CGA. CGA, arginine. Arginine, and then the next one is UAA. UAA. Well here, they have this little black, circular dot, what does that mean? Well, that means stop codon, and sometimes they'll just write the word stop there. So, this is stop. There is not an amino acid called stop, this actually signals to, and this is happening at a ribosome, this is signaling for the translation process to stop, this is the end of our amino acid chain, of our polypeptide chain. And so, we will stop right over there. But now, let's do some interesting things. Let's think about situations where there are mutations, where some of these bases, maybe something gets inserted, maybe something gets deleted, maybe something gets swapped out. And so, let's start with what's known as a point mutation, so let's say this C gets swapped out for an A. Well, if that happened, then on the RNA strand, all of a sudden this would be a uracil, and if that is a uracil, this AAG would still be there, coding for lysine, but this second codon is now different. What would it now code for? Well, CUA. CUA, it'll now code for leucine instead of arginine. Leucine, l-e-u. This is fairly typical for a substitution mutation. It might change a particular amino acid, but sometimes, it could be more significant. For example, if this G was swapped out for an A, then this C on the RNA would then be a U, and then what would happen? Well, this first codon would still code for lysine, but the second one would be UGA. UGA. Now, all of a sudden, it codes for a stop codon, and so, the actual translation process would stop, which could be a very, very big deal if this DNA sequence, if the normal, non-mutated polypeptide had to keep going on, and on, and on. Over here, it just happened to have a stop codon next, but you could imagine, if they had just, you know, another thousand codons before the end, but all of a sudden, you had a point mutation to stop early, that would significantly affect the protein that it's coding for. Now, another type of mutation that typically has a fairly significant affect is a frameshift mutation, and that's where something gets inserted or deleted and shifts everything. So, for example, instead of the A being swapped in for the G, what if the A got inserted here? So then, our sequence would look like this. T-T-C, and then we have A, and then you have G-C-T, G-C-T-A-T-T-T. So, what just happened here, this was our original sequence, but the A got inserted here, it didn't replace the G, and so everything got shifted to the right. Now, what are we coding for? Well, when we transcribe to RNA, this will be A-A-G-U-C-G-A-U-A-A-A, and now this first codon still codes for lysine, we've seen that multiple times. But, what about this second codon? This second codon over here, UCG. UCG, that's serine, we got a different amino acid. And what's interesting is, it's not just that one amino acid is changing, we're gonna see that keeps happening. So now, we have AUA. AUA. Here, we have isoleucine. So, isoleucine, right over here, which is different than what we had before, we don't have a stop codon anymore, and we would keep going on and on. And so, you could imagine a frameshift mutation where you either insert something or you take it out so that the whole frame gets shifted, can have a dramatic impact on what it will transcribe and then translate for. Now, lucky for us, even though mutations are always going on, there are many proofreading mechanisms in biological systems to make them less frequent than they otherwise would be, and people are still understanding how these proofreading mechanisms fully happen. Another thing to appreciate is, we often associate a mutation as being equal to a bad thing, and often times, it is a bad thing. What used to be a functional protein may no longer be a functional protein because the amino acids, the coding got stopped short or there was a frameshift mutation that's just coding for completely different things. So, sometimes it could be very bad, and some diseases actually are caused by strange mutations like that, that show up. Often times, the mutation might not be a big deal. Maybe something gets swapped out, maybe only one amino acid changes and it doesn't really change the ability of the protein to do its job, in which case it doesn't matter, but every now and then, a mutation can actually be a good thing. In fact, we need the mutation in order to have variation in a population, and variation is what natural selection and evolution run off of. If you don't have variation, then you're not going to have different things that get selected in different environments and you're not going to have that gradual change over time. So, a big picture, hopefully you got a better appreciation for how transcription, and then translation, let me write that down. And then, so that's transcription from DNA to RNA, and then this is translation. Translation from RNA to protein, to protein. We have appreciation of how that happens, we got appreciation of how to use these translation tables, but also how either a point mutation or a frameshift mutation can eventually affect the protein that gets coded for.