Why in the last example, using an actual RNA molecule, is methionine coded by the codon AUC? Methionine is referenced as being coded by the codon AUG in the table provided.

That was a mistake! Thank you for noticing and pointing it out. It should be fixed now :)

Why are the introns referred to as "junk" (RNA splicing section)? Don't they play a role in gene expression regulation? Thank you.

I think they are only considered "junk" in terms of what they contribute to the resultant protein. They do likely play a role in regulation, but because they are spliced out before translation, they will not effect the protein that results from translating the mature mRNA sequence.

Is it possible that DNA introns/splicing exist so that bacteria can't copy eukaryotes' DNA and express the same proteins? As they are known to steal DNA that floats around in general..

I am not aware of that but sounds interesting! That is interesting point of view because Prokaryotes do not have introns (and can't because of couples translation to transcription).

why does the introns exist at the first place just waiting to be splice ?

Lim Pin Seng, Introns allow for alternative splicing; generating multiple proteins from a single gene. It adds a layer of complexity to an organism, without having to drastically extend the genome length. In return, it may also save energy as the cell does not have to replicate as long of a genome - a reasonable explanation as to why introns may be favored. Further, introns may possess regulatory processes or code for functional RNA products. In addition, introns may also be mobile elements, contributing to the overall variation of the genetic pool. Hope this helps!

In the little drop-section explaining more about spliceosomes, it states "Once the intron has been cut out, the spliceosome will "glue" (ligate) the flanking exons together." How would this work with alternative splicing? Additionally for alternative splicing, can only one exon be removed? More alternatives could be created through removing two exons or switching the exons around. Ex: 145 and 14235

Good question! Control of alternative splicing is very complex — it often involves binding of proteins or small RNAs to the pre-mRNA in ways that favor or inhibit use of specific splice sites. The wikipedia article on this seems like a good place to start learning more: https://en.wikipedia.org/wiki/Alternative_splicing While skipping an exon is very common, there are probably examples of almost any pattern you can think of! An extreme example of how complex alternative splicing can get is the _Dscam_ gene of _Drosophila_ (a fly), which apparently has ~38,000 different splicing variants and roles in both the immune system and nervous system development†. Does that help? †Reference: https://www.cell.com/cell/fulltext/S0092-8674(00)80878-8

What happens to the introns that have been spliced?

After transcription of a eukaryotic pre-mRNA, its introns are removed by the spliceosome, joining exons for translation. The intron products of splicing have long been considered 'junk' and destined only for destruction.

Why prokaryotes do not require these post trancriptional mechanisms as needed in case of Eukaryotes? Does it mean that Eukaryotes' trancripts are free of introns?

Prokaryotes do have some post-transcriptional modifications, but introns are much less common and as far as I know are always self-splicing — i.e. don't require a spliceosome. Mature mRNAs in eukaryotes generally lack introns, but note that alternative splicing means some sequences can act as either introns or exons,

Main content

Course: Biology library > Unit 18

Lesson 2: Transcription

Eukaryotic pre-mRNA processing

Google Classroom

5' cap and poly-A tail. Splicing, introns, and exons.

Key points:

When an RNA transcript is first made in a eukaryotic cell, it is considered a pre-mRNA and must be processed into a messenger RNA (mRNA).
A 5' cap is added to the beginning of the RNA transcript, and a 3' poly-A tail is added to the end.
In splicing, some sections of the RNA transcript (introns) are removed, and the remaining sections (exons) are stuck back together.
Some genes can be alternatively spliced, leading to the production of different mature mRNA molecules from the same initial transcript.

Introduction

Imagine that you run a book-making factory, and you've just printed up all the pages of your favorite book. Now that you have the pages, is the book ready to go? Well...books usually have front and back covers. So you might want to put those on. Also, were there any blank or messed-up pages made during printing? You should probably check for those and remove them before selling your books, or you might end up with some unhappy customers.

The steps we just talked about are pretty similar to what happens to RNA transcripts in the cells of your body. In humans and other eukaryotes, a freshly made RNA transcript (hot off the RNA polymerase "presses") is not quite ready to go. Instead, it's called a pre-mRNA and has to go through some processing steps to become a mature messenger RNA (mRNA) that can be translated into a protein. These include:

Addition of cap and tail molecules to the two ends of the transcript. These play a protective role, like a book's front and back covers.
Removal of "junk" sequences called introns. Introns are sort of like blank or messed-up pages made during a book's printing, which have to be removed in order for the book to be readable .

In this article, we'll take a closer look at the cap, tail, and splicing modifications that eukaryotic RNA transcripts receive, seeing how they're carried out and why they are important for making sure we get the right protein from our RNA.

Overview of pre-mRNA processing in eukaryotes

As a quick review, gene expression (the "reading out" of a gene to make a protein, or chunk of a protein) happens a little bit differently in bacteria and eukaryotes such as humans.

In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins right away. In eukaryotes, things are a little more complex, though in an pretty interesting way. The molecule that's directly made by transcription in one of your (eukaryotic) cells is called a pre-mRNA, reflecting that it needs to go through a few more steps to become an actual messenger RNA (mRNA). These are:

Addition of a 5' cap to the beginning of the RNA
Addition of a poly-A tail (tail of A nucleotides) to the end of the RNA
Chopping out of introns, or "junk" sequences, and pasting together of the remaining, good sequences (exons)

Once it's completed these steps, the RNA is a mature mRNA. It can travel out of the nucleus and be used to make a protein.

5' cap and poly-A tail

Both ends of a pre-mRNA are modified by the addition of chemical groups. The group at the beginning (5' end) is called a cap, while the group at the end (3' end) is called a tail. Both the cap and the tail protect the transcript and help it get exported from the nucleus and translated on the ribosomes (protein-making "machines") found in the cytosol

^{1}

The 5’ cap is added to the first nucleotide in the transcript during transcription. The cap is a modified guanine (G) nucleotide, and it protects the transcript from being broken down. It also helps the ribosome attach to the mRNA and start reading it to make a protein.

How is the poly-A tail added? The 3' end of the RNA forms in kind of a bizarre way. When a sequence called a polyadenylation signal shows up in an RNA molecule during transcription, an enzyme chops the RNA in two at that site. Another enzyme adds about

100

-

200

adenine (A) nucleotides to the cut end, forming a poly-A tail. The tail makes the transcript more stable and helps it get exported from the nucleus to the cytosol.

RNA splicing

The third big RNA processing event that happens in your cells is RNA splicing. In RNA splicing, specific parts of the pre-mRNA, called introns are recognized and removed by a protein-and-RNA complex called the spliceosome. Introns can be viewed as "junk" sequences that must be cut out so the "good parts version" of the RNA molecule can be assembled.

What are the "good parts"? The pieces of the RNA that are not chopped out are called exons. The exons are pasted together by the spliceosome to make the final, mature mRNA that is shipped out of the nucleus.

A key point here is that it's only the exons of a gene that encode a protein. Not only do the introns not carry information to build a protein, they actually have to be removed in order for the mRNA to encode a protein with the right sequence. If the spliceosome fails to remove an intron, an mRNA with extra "junk" in it will be made, and a wrong protein will get produced during translation.

Splicing needs to precise and consistent. This careful cutting and pasting is performed by the spliceosome, an enzyme complex made of protein and small RNAs. Most introns contain marker sequences at both of their ends, which are recognized by the small RNAs and direct the spliceosome to remove the intron. Once the intron has been cut out, the spliceosome will "glue" (ligate) the flanking exons together.

Alternative splicing

Why splice? We don't know for sure why splicing exists, and in some ways, it seems like a wasteful system. However, splicing does allow for a process called alternative splicing, in which more than one mRNA can be made from the same gene. Through alternative splicing, we (and other eukaryotes) can sneakily encode more different proteins than we have genes in our DNA.

In alternative splicing, one pre-mRNA may be spliced in either of two (or sometimes many more than two!) different ways. For example, in the diagram below, the same pre-mRNA can be spliced in three different ways, depending on which exons are kept. This results in three different mature mRNAs, each of which translates into a protein with a different structure.

_Image credit: "DNA, alternative splicing," by the National Human Genome Research Institute (public domain)._

Great question! Professional biologists would like to know the answer too. It's not totally clear why introns and splicing are so widespread in eukaryotes.

One possibility is that splicing in general permits alternative splicing, which appears to be important for eukaryotes (by allowing them to make more different proteins from a single gene). Also, introns sometimes contain regulatory sequences that control the expression of a gene (aren't really "junk)

^{2}

. Sometimes, small RNAs that regulate gene expression come from introns that are spliced out

^{3}

. Also, the existence of exons and introns may make it easier for new genes and alleles to form through mutation events that mix and match gene segments, which could have evolutionary advantages

^{2, 4}

Try it yourself: Splice the message

Your mission, should you choose to accept it: decode the following top-secret message. First, remove the "junk" letters, colored in purple and underlined. Second, put the remaining letters into groups of three, starting at the beginning.

THEDOGR

\underset{―}{AMAPQ}

ANANDA

\underset{―}{ZAPTQM}

TETHEHAT

Have you given it a try?

If you remove the purple sequences, you should get this series of letters:
If you group the remaining letters into sets of three, you should get this message:

The process you just went through is basically what your cells must do when they express a gene. As we discussed earlier in the article, most eukaryotic pre-mRNAs contain "junk" sequences called introns, which are like the purple letters in the message. These sequences must be removed, and the meaningful sequences (exons), equivalent to the maroon letters in the message above, must be stuck back together to make a mature mRNA.

During translation, the mRNA sequence is read in groups of three nucleotides. Each three-letter "word" corresponds to an amino acid that's added to a polypeptide (protein or protein subunit). If an RNA hasn't been spliced, it will contain extra nucleotides that it shouldn't, leading to an incorrect protein "message." Something similar happens if we try to decode the message above without removing the purple letters:

THE DOG R

\underset{―}{AM APQ}

ANA NDA

\underset{―}{ZAP TQM}

TET HEH AT

Just as removing the purple letters from the sentence is key to ending up with the right message, so splicing is key to ensuring that an mRNA carries the right information (and directs production of the correct polypeptide).

Here is the pre-mRNA sequence, with exons in bold maroon letters and one intron in underlined purple letters:

5’- … AUGCACUAU

\underset{―}{GUAUGUGCCUUUUUGUGCUGUG}

GAAGCGUAA … -3’

If the pre-mRNA is correctly spliced, the nucleotides of the mature mRNA are read in groups of three as follows, producing the polypeptide shown below:

5’- … AUG CAC UAU

GAA GCG UAA … -3’

Met - His - Tyr - Glu - Ala - STOP

If the intron is not removed from the pre-mRNA, the resulting abnormal mRNA contains extra nucleotides. When its nucleotides are read in groups of three, as shown below, a polypeptide with an incorrect amino acid sequence is produced. There are too many amino acids, and the amino acids specified by the second exon are not produced (because the reading frame is shifted):

5’- … AUG CAC UAU

\underset{―}{GUA UGU GCC UUU UUG UGC UGU G}

GA AGC GUA A … -3’

Met - His - Tyr - Val - Cys - Ala - Phe - Leu - Cys - Cys - Gly - Ser - Val …

All of the above relationships between groups of nucleotides and the amino acids they encode can be determined using the genetic code table:

_Image credit: "The genetic code: Figure 3," by OpenStax College, Biology (CC BY 3.0)._

Intron sequence modified from Bourdin et al.

^{4}

This article is licensed under a CC BY-NC-SA 4.0 license.

Works cited:

Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., and Jackson, R. B. (2011). Alteration of mRNA ends. In Campbell biology (10th ed., p. 342-343). San Francisco, CA: Pearson.
Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., and Jackson, R. B. (2011). The functional and evolutionary importance of introns. In Campbell biology (10th ed., p. 344). San Francisco, CA: Pearson.
Keren, H., Lev-Maor, G., and Ast, G. (2010). Alternative splicing and evolution: diversification, exon definition and function. Nature Reviews Genetics, 11, 345-355. http://dx.doi.org/10.1038/nrg2776. Retrieved from https://www.tau.ac.il/~gilast/PAPERS/nrg2776.pdf.
Standage, D. (2012, April 8). Why do eukaryotic organisms have introns in their DNA? [Answer] In Biology stack exchange. Retrieved from http://biology.stackexchange.com/questions/1724/why-do-eukaryotic-organisms-have-introns-in-their-dna.
Bourdin, C. M., Moignot, B., Wang, L., Murillo, L., Juchaux, M., Quinchard, S., Lapied, B., Guérineau, N. C., Dong, K., and Legros, C. (2013). Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity. PLoS ONE, 8(8), e67290. http://dx.doi.org/10.1371/journal.pone.0067290.

Additional references:

3'-end cleavage and polyadenylation. (2016). In Nobelprize.org. Retrieved from http://www.nobelprize.org/educational/medicine/dna/a/splicing/splicing_endformation.html.

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002). Posttranscriptional controls. In Molecular biology of the cell (4th ed.). New York, NY: Garland Science. Retrieved from http://www.ncbi.nlm.nih.gov/books/NBK26890/.

Intron/introns. (2014). In Scitable. Retrieved from http://www.nature.com/scitable/definition/intron-introns-67.

Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D., and Darnell, J. (2000). Processing of eukaryotic mRNA. In Molecular cell biology (4th ed., section 11.2). New York, NY: W. H. Freeman. Retrieved from http://www.ncbi.nlm.nih.gov/books/NBK21563/.

Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D., and Darnell, J. (2000). Transcription termination. In Molecular cell biology (4th ed., section 11.1). New York, NY: W. H. Freeman. Retrieved from http://www.ncbi.nlm.nih.gov/books/NBK21601/.

Polyadenylation. (2016, January 24). Retrieved February 11, 2016 from Wikipedia: https://en.wikipedia.org/wiki/Polyadenylation.

Raven, P. H., Johnson, G. B., Mason, K. A., Losos, J. B., and Singer, S. R. (2014). Genes and how they work. In Biology (10th ed., AP ed., pp. 278-303). New York, NY: McGraw-Hill.

Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., and Jackson, R. B. (2011). Eukaryotic cells modify RNA after transcription . In Campbell biology (10th ed., p. 342-345). San Francisco, CA: Pearson.

Want to join the conversation?

Sort by:

isaacboardman
Posted 8 years ago. Direct link to isaacboardman's post “Why in the last example, ...”
Why in the last example, using an actual RNA molecule, is methionine coded by the codon AUC? Methionine is referenced as being coded by the codon AUG in the table provided.
Button navigates to signup pageComment on isaacboardman's post “Why in the last example, ...”
(23 votes)
Answer
- emilyabrash
  Posted 8 years ago. Direct link to emilyabrash's post “That was a mistake! Thank...”
  That was a mistake! Thank you for noticing and pointing it out. It should be fixed now :)
  Button navigates to signup page
  (29 votes)
Lim Pin Seng
Posted 8 years ago. Direct link to Lim Pin Seng's post “why does the introns exis...”
why does the introns exist at the first place just waiting to be splice ?
Button navigates to signup pageComment on Lim Pin Seng's post “why does the introns exis...”
(4 votes)
Answer
- Kevin D. Fettel
  Posted 8 years ago. Direct link to Kevin D. Fettel's post “Lim Pin Seng, Introns a...”
  Lim Pin Seng,
  
  Introns allow for alternative splicing; generating multiple proteins from a single gene. It adds a layer of complexity to an organism, without having to drastically extend the genome length. In return, it may also save energy as the cell does not have to replicate as long of a genome - a reasonable explanation as to why introns may be favored.
  
  Further, introns may possess regulatory processes or code for functional RNA products. In addition, introns may also be mobile elements, contributing to the overall variation of the genetic pool.
  
  Hope this helps!
  Button navigates to signup page
  (26 votes)
fiacl
Posted 7 years ago. Direct link to fiacl's post “Why are the introns refer...”
Why are the introns referred to as "junk" (RNA splicing section)? Don't they play a role in gene expression regulation? Thank you.
Button navigates to signup pageComment on fiacl's post “Why are the introns refer...”
(5 votes)
Answer
- wrharris93
  Posted 7 years ago. Direct link to wrharris93's post “I think they are only con...”
  I think they are only considered "junk" in terms of what they contribute to the resultant protein. They do likely play a role in regulation, but because they are spliced out before translation, they will not effect the protein that results from translating the mature mRNA sequence.
  Button navigates to signup page
  (7 votes)
Maria Pikoula
Posted 5 years ago. Direct link to Maria Pikoula's post “Is it possible that DNA i...”
Is it possible that DNA introns/splicing exist so that bacteria can't copy eukaryotes' DNA and express the same proteins? As they are known to steal DNA that floats around in general..
Button navigates to signup pageButton navigates to signup page
(5 votes)
Answer
- Ivana - Science trainee
  Posted 5 years ago. Direct link to Ivana - Science trainee's post “I am not aware of that bu...”
  I am not aware of that but sounds interesting!
  That is interesting point of view because Prokaryotes do not have introns (and can't because of couples translation to transcription).
  Button navigates to signup page
  (3 votes)
draawt
Posted 2 years ago. Direct link to draawt's post “Why there is only Poly A ...”
Why there is only Poly A tail? What can be possible problems with Poly G, U or C?
Button navigates to signup pageButton navigates to signup page
(6 votes)
Answer
Lucas
Posted 3 years ago. Direct link to Lucas's post “RNA splicing is done by s...”
RNA splicing is done by spliceosome, protein, but how can it be made in the first place? Does it just not need spliceosome to be made?
Button navigates to signup pageButton navigates to signup page
(4 votes)
Answer
Seaj1
Posted 5 years ago. Direct link to Seaj1's post “In the little drop-sectio...”
In the little drop-section explaining more about spliceosomes, it states "Once the intron has been cut out, the spliceosome will "glue" (ligate) the flanking exons together." How would this work with alternative splicing? Additionally for alternative splicing, can only one exon be removed? More alternatives could be created through removing two exons or switching the exons around. Ex: 145 and 14235
Button navigates to signup pageButton navigates to signup page
(3 votes)
Answer
- tyersome
  Posted 5 years ago. Direct link to tyersome's post “Good question! Control o...”
  Good question!
  
  Control of alternative splicing is very complex — it often involves binding of proteins or small RNAs to the pre-mRNA in ways that favor or inhibit use of specific splice sites.
  
  The wikipedia article on this seems like a good place to start learning more:
  https://en.wikipedia.org/wiki/Alternative_splicing
  
  While skipping an exon is very common, there are probably examples of almost any pattern you can think of!
  
  An extreme example of how complex alternative splicing can get is the Dscam gene of Drosophila (a fly), which apparently has ~38,000 different splicing variants and roles in both the immune system and nervous system development†.
  
  Does that help?
  
  †Reference: https://www.cell.com/cell/fulltext/S0092-8674(00)80878-8
  Button navigates to signup page
  (2 votes)
RichardT
Posted 6 months ago. Direct link to RichardT's post “What happens to the intro...”
What happens to the introns that have been spliced?
Button navigates to signup pageButton navigates to signup page
(3 votes)
Answer
- Victor205
  Posted 5 months ago. Direct link to Victor205's post “After transcription of a ...”
  After transcription of a eukaryotic pre-mRNA, its introns are removed by the spliceosome, joining exons for translation. The intron products of splicing have long been considered 'junk' and destined only for destruction.
  Button navigates to signup page
  (2 votes)
Shashank Shekhar
Posted 6 years ago. Direct link to Shashank Shekhar's post “Why prokaryotes do not re...”
Why prokaryotes do not require these post trancriptional mechanisms as needed in case of Eukaryotes? Does it mean that Eukaryotes' trancripts are free of introns?
Button navigates to signup pageButton navigates to signup page
(3 votes)
Answer
- tyersome
  Posted 6 years ago. Direct link to tyersome's post “Prokaryotes do have some ...”
  Prokaryotes do have some post-transcriptional modifications, but introns are much less common and as far as I know are always self-splicing — i.e. don't require a spliceosome.
  
  Mature mRNAs in eukaryotes generally lack introns, but note that alternative splicing means some sequences can act as either introns or exons,
  Button navigates to signup page
  (2 votes)
Ishaan
Posted 3 years ago. Direct link to Ishaan's post “Please tell me if I under...”
Please tell me if I understand correctly. RNA polymerase runs through the DNA and produces RNA. This RNA then is modified and turned into pre mRNA. Then this pre mRNA is modified and its introns are removed, it gets a guanine on the 5' end and 4 adenines on the 3' end and turned into mature mRNA.
Button navigates to signup pageComment on Ishaan's post “Please tell me if I under...”
(3 votes)
Answer
- Emma Gao
  Posted 3 years ago. Direct link to Emma Gao's post “Correct! Nice work :)”
  Correct! Nice work :)
  Button navigates to signup page
  (2 votes)